Creating Parts

Add genetic parts to your library for reuse across constructs.

Create a Part Manually

1. Click New > Part in the header, or use the dashboard Create new section

2. Fill in the part details:

   • Name: A descriptive name (e.g., "CMV Promoter")

   • Type: Select the part type (Promoter, CDS, Terminator, etc.)

   • Sequence: Enter or paste the DNA sequence

3. Add optional metadata:

   • Description: What the part does

   • Attributes: Custom fields for your workflow

4. Choose a destination repository

5. Click Create

Part Creation Modal

Create Parts from a Construct

Extract parts from an existing construct:

1. Open the construct in the editor

2. Select a sequence region by clicking and dragging

3. Right-click and select Create part from selection

4. Fill in the part details

5. Click Create

The new part is linked to the selected region.

Import Parts from Files

Import parts from GenBank or other file formats:

1. Click New > Part

2. Select Import from file

3. Upload a GenBank (.gb), FASTA (.fasta), or DNA (.dna) file

4. Review the imported sequence and annotations

5. Set the part type and metadata

6. Click Create

Bulk Part Import

Import multiple parts at once using CSV:

1. Prepare a CSV file with columns:

   • name (required)

   • sequence (required)

   • type (required)

   • description (optional)

   • Additional attribute columns as needed

2. Go to Tools > Bulk Import

3. Upload your CSV file

4. Map columns to part fields

5. Select a destination repository

6. Click Import

CSV Example

name,sequence,type,description
T7 Promoter,TAATACGACTCACTATAGGG,Promoter,T7 RNA polymerase promoter
GFP,ATGGTGAGCAAGGGCGAGGAG...,CDS,Green fluorescent protein
BGH Terminator,CTGTGCCTTCTAGTTGCCAGC...,Terminator,Bovine growth hormone terminator

Edit a Part

1. Navigate to the part in a repository or search for it

2. Double-click to open

3. Modify the sequence, type, or metadata

4. Changes save automatically (or click Save)

Part Versioning

Kernel tracks part revisions:

• View history in the History panel

• See what changed between versions

• Parts used in constructs reference specific versions

Best Practices

Naming Conventions

• Use descriptive names: "CMV Promoter" not "Promoter1"

• Include version if relevant: "Kozak v2"

• Be consistent across your team

Metadata

• Always set the correct part type

• Add descriptions for future reference

• Use attributes for searchable metadata (organism, source paper, etc.)

Organization

• Create dedicated parts repositories

• Use folders to organize by type or project

• Share commonly used parts workspace-wide

Next Steps

• Part Library — Access public parts

• What is a Part? — Part types and properties

• Drag and Drop Assembly — Build constructs from parts